View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12659_high_29 (Length: 253)
Name: NF12659_high_29
Description: NF12659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12659_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 35413908 - 35413688
Alignment:
| Q |
14 |
agacctacaaagtggaatttattgtggacccagattttggtgttcctggagctatcacagttgttaactattatgacaacgagctcttcttggaaagcat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35413908 |
agacctacaaagtggaatttattgtggacccagattttggtgttcctggagctatcacagttgttaactattatgacaacgagctcttcttggaaagcat |
35413809 |
T |
|
| Q |
114 |
aaacatcagacaaagtatttgtttcacatgcaagtcttgggtccaaccaaataggcttcacccagacaagagaatcttcttcgtcaacaaggtaaattta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35413808 |
aaacatcagacaaagtatttgtttcacatgcaagtcttgggtccaaccaaataggcttcacccagacaagagaatcttcttcgtcaacaaggtaaattta |
35413709 |
T |
|
| Q |
214 |
caaggctaagattcatggaaa |
234 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
35413708 |
cagggctaagattcatggaaa |
35413688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University