View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12659_low_20 (Length: 359)
Name: NF12659_low_20
Description: NF12659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12659_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 42 - 163
Target Start/End: Complemental strand, 49767101 - 49766980
Alignment:
| Q |
42 |
aagagttaacattggtgttgaagatgattccattgatggcatgcaatgcattgatcatccatacagaaacaaccctggtgggatctgtgctttttgtctt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49767101 |
aagagttaacattggtgttgaagatgattccattgatggcatgcaatgcattgatcatccatatagaaacaaccctggtgggatctgtgctttttgtctt |
49767002 |
T |
|
| Q |
142 |
caagaaaaacttggtaaactcg |
163 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49767001 |
caagaaaaacttggtaaactcg |
49766980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 262 - 349
Target Start/End: Complemental strand, 49766881 - 49766791
Alignment:
| Q |
262 |
actactcgtcattgtccttcttcttcttc---catcaacactgtatcagctacaactgctgtaacttcatcttcttctctctcactctctg |
349 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766881 |
actactcgtcattgtccttcttcttcttcttccatcaacactgtatcagcaacaactgctgtaacttcatcttcttctctctcactctctg |
49766791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 115 - 161
Target Start/End: Original strand, 14137707 - 14137753
Alignment:
| Q |
115 |
cctggtgggatctgtgctttttgtcttcaagaaaaacttggtaaact |
161 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14137707 |
cctggtggtatatgtgctttttgtcttcaagaaaaacttggtaaact |
14137753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University