View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12659_low_32 (Length: 280)
Name: NF12659_low_32
Description: NF12659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12659_low_32 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 18 - 280
Target Start/End: Complemental strand, 9433938 - 9433676
Alignment:
| Q |
18 |
cttaacagagcaaagcttgtacagcgtcgttaatgcatctttcttccctctgtttgaaccgtttaacagaagcgaaaccaatggtggaatcgctcccgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9433938 |
cttaacagagcaaagcttgtacagcgtcgttaatgcatctttcttccctctgtttgaaccgtttaacagaagcgaaaccaatggtggaatcgctcccgaa |
9433839 |
T |
 |
| Q |
118 |
gctccaattgagcttttattctcttccaccaacgctaaactcagcagagcacaagcggcgttctgcttagaagtctctgtcccagttttcaatacataaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9433838 |
gctccaattgagcttttattctcttccaccaacgctaaactcagcagagcacaagcggcgttctgcttagaagtctctgtcccagttttcaatacataaa |
9433739 |
T |
 |
| Q |
218 |
tcaacgatttcacagctccagcattaaatatcagtttcttattatcttcatgaagagaaagat |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9433738 |
tcaacgatttcacagctccagcattaaatatcagtttcttattatcttcatgaagagaaagat |
9433676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University