View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12659_low_33 (Length: 270)
Name: NF12659_low_33
Description: NF12659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12659_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 20 - 261
Target Start/End: Complemental strand, 9585898 - 9585656
Alignment:
| Q |
20 |
ttgataacataaaaatacattatcgttgcatagtgtttaaatttgttaattaattatataatttctatctaatatgatcttaactttttgcttttgttgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9585898 |
ttgataacataaaaatacattatcgttgcatagtgtttaaatttgttaattaattatataatttctatctaatatgatcttaactttttgcttttgttgg |
9585799 |
T |
 |
| Q |
120 |
gaggagggaggagttgagggattgggggaagtataatagcaaaaagacaagtctaagaa-gaggaataatcttgggaggtcatcatgctttgattgaata |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9585798 |
gaggagggaggagttgagggcttgggggaagtataatagcaaaaagacaagtctaagaaggaggaataatcttgggaggtcatcatgctttgattgaata |
9585699 |
T |
 |
| Q |
219 |
attatgtatgacaaagacaaacataccaacattcttctctctc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9585698 |
attatgtatgacaaagacaaacataccaacattcttttctctc |
9585656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University