View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12659_low_34 (Length: 266)
Name: NF12659_low_34
Description: NF12659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12659_low_34 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 13 - 266
Target Start/End: Complemental strand, 43764575 - 43764322
Alignment:
| Q |
13 |
tggacatcctaattgaggagcatgaacatcaacccaaacctcattcctcctcttagcaatcctaaaaggaccattatactgtgcaatcgaatacccacct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43764575 |
tggacatcctaattgaggagcatgaacatcaacccaaacctcattcctcctcttagcaatcctaaaaggaccattatactgtgcaatcgaatacccacct |
43764476 |
T |
|
| Q |
113 |
tttctcttcacctcactctcaccaccccacctactcaaactcaaatccagcttctccgcttccttaacaactttctcatcctttgcaaaccccgaaaacc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
43764475 |
tttctcttcacctcactctcaccaccccacctactcaaactcaaatccagcttctccgcttccttaacaaccttctcatcctttgcaaaccccgaaaatc |
43764376 |
T |
|
| Q |
213 |
ctctcaccgcaacacaatgactctcaaatccatagctcttaatattcaattccg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43764375 |
ctctcaccgcaacacaatgactctcaaaaccatagctcttaatattcaattccg |
43764322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University