View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12659_low_52 (Length: 226)
Name: NF12659_low_52
Description: NF12659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12659_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 66 - 223
Target Start/End: Original strand, 18135528 - 18135685
Alignment:
| Q |
66 |
atctaggaatacatattcatgcaaaatgaaaattataatattttcttagatgtgtaattcccaagtgattttggtgtgagaaaattcctctctaaatgca |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18135528 |
atctaggaatacatattcatgcaaaatgaaaattataatattttcttagatgtgtaattcccaagtgattttggtgtgataaaattcctctctaaatgca |
18135627 |
T |
 |
| Q |
166 |
tctttccaacggctgatttgcttaaggaaaattctcattctctgatgtccatctcatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| || |||| | ||||||| |
|
|
| T |
18135628 |
tctttccaacggctgatttgcttaaggaaaattcccattcacttatgtacctctcatt |
18135685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 49
Target Start/End: Original strand, 18135462 - 18135496
Alignment:
| Q |
15 |
cataggtcacacatgggaatgagacaaaaaacgtg |
49 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18135462 |
cataggtcacacatgagaatgagacaaaaaacgtg |
18135496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University