View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12659_low_54 (Length: 216)
Name: NF12659_low_54
Description: NF12659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12659_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 52003180 - 52003362
Alignment:
| Q |
19 |
aaactactggcatttcaggtgattgtattggctccattttacatgttgtttgcagctccaaattctgaagctcatcatcaagcaaaccttgatcttcttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52003180 |
aaactactggcatttcaggtgattgtattggctccattttacatgttgtttgcagctccaaattctgaagctcatcatcaagcaaaccttgatcttcttc |
52003279 |
T |
|
| Q |
119 |
tcccatcatggacagtggaaagtcttcttgagaaataaatggagtgtcaatactattattatagtacgaaccaagaatctgtg |
201 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52003280 |
tcccatcatggacagtgaaaagtcttcttgagaaataaatggagtgtcaatactattattatagtacgaatcaagaatctgtg |
52003362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University