View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1265_low_18 (Length: 333)

Name: NF1265_low_18
Description: NF1265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1265_low_18
NF1265_low_18
[»] chr4 (1 HSPs)
chr4 (102-318)||(53013814-53014029)


Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 102 - 318
Target Start/End: Complemental strand, 53014029 - 53013814
Alignment:
102 aattagaacggggaggatcagctagaggaatatggttaaaaatctcgtctaaattataaacttattgaattagtgtttaaagtgaaaggtttttacaatg 201  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
53014029 aattagaacggggaggatcagccagaggaatatggttaaaaatctcgtctaaattataa-cttattgaattagtgtttaaagtgaaaggtttttacaatg 53013931  T
202 cggtgaatttcagtatttgatcttgtcgagatcttgagacaactgacgaatggaagaaggctccttgaatgtttggtcagcctcaaggatgagtgtatct 301  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53013930 cggtgaatttcagtatttgatcttgtcgagatcttgagacaactgacgaatggaagaaggctccttgaatgtttggtcagcctcaaggatgagtgtatct 53013831  T
302 gcaaaagacacttagat 318  Q
    |||||||||||||||||    
53013830 gcaaaagacacttagat 53013814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University