View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1265_low_23 (Length: 317)
Name: NF1265_low_23
Description: NF1265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1265_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 97 - 234
Target Start/End: Original strand, 3001709 - 3001846
Alignment:
| Q |
97 |
agtattaactagtttatcatctatgaactcatcctggtatctggttgtaagaaaacacaagctaacatttgatgtgcacgttcaagttgggtacaaattc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3001709 |
agtattaactagtttatcatctatgaactcatcctggtatctggttgtaagaaaacacaagctaacatttgatgtgcacgttcaagttgggtacaaattc |
3001808 |
T |
 |
| Q |
197 |
cagcttcattaattgacggtcaaatattaatgctctct |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3001809 |
cagcttcattaattgacggtcaaatattaatgctctct |
3001846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University