View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1265_low_28 (Length: 281)
Name: NF1265_low_28
Description: NF1265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1265_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 60 - 237
Target Start/End: Complemental strand, 30473810 - 30473634
Alignment:
| Q |
60 |
gtataaaacaaaaaatagttatgcaactaatcattccatgctcatcaaacaaaaacatttagtaaactacaaaaaatggataacagttgaaaactacctt |
159 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30473810 |
gtataaaccaaaaaatagttatgcaactaatcattccatgctcatcaaacaaaa-catttagtaaactacgaaaaatggataacagttgaaaactacctt |
30473712 |
T |
 |
| Q |
160 |
aaaacattttacagctttggcaatccatcctagagggtggtgatgcagttcttctgaatcagaactttgcatttcatc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30473711 |
aaaacattttacagctttggcaatccatcctagagggtggtgatgcagttcttctgaatcagaactttgcatttcatc |
30473634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University