View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1265_low_29 (Length: 273)
Name: NF1265_low_29
Description: NF1265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1265_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 101 - 244
Target Start/End: Original strand, 35096147 - 35096287
Alignment:
| Q |
101 |
aattaattcagatagaaatagagatccatagagtgagtgagattaattaataatcaattgaccaagtccttaattttatttaatttttgtgtttatcaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35096147 |
aattaattcagatagaaatagagatccatagagtgagtgagattaattaat---caattgaccaagtccttaattttatttaatttttgtgtttatcaaa |
35096243 |
T |
 |
| Q |
201 |
gaaaattccttcgcataccagaaatgcacggccagcctttgaat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35096244 |
gaaaattccttcgcataccagaaatgcacggccagcctttgaat |
35096287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 5 - 53
Target Start/End: Original strand, 35096046 - 35096094
Alignment:
| Q |
5 |
gagaagcaaaggcaaggagcagaaagaaacaaagctaataatagagtaa |
53 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35096046 |
gagaaacaaacgcaaggagcagaaagaaacaaagctaataatagagtaa |
35096094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University