View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1265_low_31 (Length: 264)

Name: NF1265_low_31
Description: NF1265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1265_low_31
NF1265_low_31
[»] chr3 (1 HSPs)
chr3 (15-181)||(2441061-2441227)


Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 15 - 181
Target Start/End: Original strand, 2441061 - 2441227
Alignment:
15 ctttcattacccttgctgtgtagtatctttatgatggtggatttgactgccattaacaagcagctcttgtgtgtcccccctcccttaagctcttctggcc 114  Q
    ||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||    
2441061 ctttcattaaccttgctgtgtagtatcattatgatggtggaattgactgccattaacaagcagttcttgtgtgtcctccctaccttaagctcttctggcc 2441160  T
115 attcattttacgacccgccacttcctacgcttccgtttgatttggtggcagagatcctgtgtaggct 181  Q
    ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2441161 attcactttatgacccgccacttcctacgcttccgtttgatttggtggcagagatcctgtgtaggct 2441227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University