View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1265_low_33 (Length: 253)
Name: NF1265_low_33
Description: NF1265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1265_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 15 - 169
Target Start/End: Original strand, 2441061 - 2441215
Alignment:
| Q |
15 |
ctttcattacccttgctgtgtagtatcattatgatggtggaattgactgccattaacaagcagctcttgtgtgtcccccctcccttaagctcttctggcc |
114 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
2441061 |
ctttcattaaccttgctgtgtagtatcattatgatggtggaattgactgccattaacaagcagttcttgtgtgtcctccctaccttaagctcttctggcc |
2441160 |
T |
 |
| Q |
115 |
attcactttacgacccgccacttcctacgcttccgtttgatttggtggcagagat |
169 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2441161 |
attcactttatgacccgccacttcctacgcttccgtttgatttggtggcagagat |
2441215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University