View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1266-Insertion-10 (Length: 158)
Name: NF1266-Insertion-10
Description: NF1266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1266-Insertion-10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 3e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 3e-77
Query Start/End: Original strand, 13 - 158
Target Start/End: Complemental strand, 36064738 - 36064593
Alignment:
| Q |
13 |
tactaaccttttcttagatgatgaagaagagtgggaagtgactgagccatcgatgttaaatgaggtggaagaaggagtggaatcttgagatatgtcagtc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064738 |
tactaaccttttcttagatgatgaagaagagtgggaagtgactgagccatcgatgttaaatgaggtggaagaaggagtggaatcttgagatatgtcagtc |
36064639 |
T |
|
| Q |
113 |
aagtcttcctcttggtgagtatgtgggtttttgaattttcttttca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064638 |
aagtcttcctcttggtgagtatgtgggtttttgaattttcttttca |
36064593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University