View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12660_high_15 (Length: 342)
Name: NF12660_high_15
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12660_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 26643248 - 26643093
Alignment:
| Q |
1 |
cttccaccttcctattcttctccttcaccttcttcaaaacgtccaatagcagatttctctgaacttcccaattctggtggtgttaaggctttggaactcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26643248 |
cttccaccttcctattcttctccttcaccttcttcaaaacgtccaatagcagatttctctgaactccccaattctggtggtgttaaggctttggaactcc |
26643149 |
T |
 |
| Q |
101 |
ttgttggttcaggtgaagttcctcaagatggagaccaggtataattctctccttta |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26643148 |
ttgttggttcaggtgaagttcctcaagatggagaccaggtataattctctccttta |
26643093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University