View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12660_high_25 (Length: 275)
Name: NF12660_high_25
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12660_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 38 - 203
Target Start/End: Complemental strand, 43373107 - 43372941
Alignment:
| Q |
38 |
gctgcaccggttatacctaacttaaagtaatacttcagtaaggaaaataaaaagactgctcaatgattaccaatgcctacaatttcataaacgtattagg |
137 |
Q |
| |
|
|||||||||| || ||| ||||||||||||||| | ||||||| |||||||||||| ||| || |||||||||||||| |||||||||||| |||||||| |
|
|
| T |
43373107 |
gctgcaccggctacacccaacttaaagtaatacataagtaagggaaataaaaagaccgctgaaagattaccaatgcctgcaatttcataaatgtattagg |
43373008 |
T |
 |
| Q |
138 |
aagacgcatgcatacaatatctgaatatcatgaatatgctttta-aatttaatctttctttgcaaca |
203 |
Q |
| |
|
|||| | |||||||||||||||||||||| ||||||| ||||| ||| ||||| ||||||| |||| |
|
|
| T |
43373007 |
aagaagtgtgcatacaatatctgaatatcaagaatatgattttagaatgtaatcattctttgaaaca |
43372941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 133 - 223
Target Start/End: Original strand, 3420211 - 3420301
Alignment:
| Q |
133 |
ttaggaagacgcatgcatacaatatctgaatatcatgaatatgcttttaaatttaatctttctttgcaacaaatgaaagactattaggaac |
223 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3420211 |
ttaggaagacacatgcatacaatatctgaatatcatgaatatgcttttaaatttgatctttctttgaaacaaatgaaagactattaggaac |
3420301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 3739982 - 3739929
Alignment:
| Q |
18 |
gaaagaggtcatactgaattgctgcaccggttatacctaacttaaagtaatact |
71 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
3739982 |
gaaagaggtcatgctgaatggctgcaccggttatacctagcttaaagtaatact |
3739929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University