View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12660_high_34 (Length: 240)

Name: NF12660_high_34
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12660_high_34
NF12660_high_34
[»] chr3 (1 HSPs)
chr3 (14-234)||(36821672-36821892)


Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 36821892 - 36821672
Alignment:
14 ataggtctgtgtttgatgtaactaagggaaaatcacattatggtccaggaggaggttatcatcactttgctggaaggtatgttctcaaaccctctttcct 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36821892 ataggtctgtgtttgatgtaactaagggaaaatcacattatggtccaggaggaggttatcatcactttgctggaaggtatgttctcaaaccctctttcct 36821793  T
114 gcttcatccatgtttttgttctgtttgtatttctaatccattgaaatatatccatttgaactcatgtttttcttggttgggatatcatgatttcagggat 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36821792 gcttcatccatgtttttgttctgtttgtatttctaatccattgaaatatatccatttgaactcatgtttttcttggttgggatatcatgatttcagggat 36821693  T
214 gcttctcgcgctttcttctct 234  Q
    |||||||||||||||||||||    
36821692 gcttctcgcgctttcttctct 36821672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University