View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12660_high_34 (Length: 240)
Name: NF12660_high_34
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12660_high_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 36821892 - 36821672
Alignment:
| Q |
14 |
ataggtctgtgtttgatgtaactaagggaaaatcacattatggtccaggaggaggttatcatcactttgctggaaggtatgttctcaaaccctctttcct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36821892 |
ataggtctgtgtttgatgtaactaagggaaaatcacattatggtccaggaggaggttatcatcactttgctggaaggtatgttctcaaaccctctttcct |
36821793 |
T |
 |
| Q |
114 |
gcttcatccatgtttttgttctgtttgtatttctaatccattgaaatatatccatttgaactcatgtttttcttggttgggatatcatgatttcagggat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36821792 |
gcttcatccatgtttttgttctgtttgtatttctaatccattgaaatatatccatttgaactcatgtttttcttggttgggatatcatgatttcagggat |
36821693 |
T |
 |
| Q |
214 |
gcttctcgcgctttcttctct |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36821692 |
gcttctcgcgctttcttctct |
36821672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University