View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12660_high_41 (Length: 232)
Name: NF12660_high_41
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12660_high_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 224
Target Start/End: Original strand, 31438797 - 31439010
Alignment:
| Q |
11 |
acatcaccatctctcccttctcaaacactcgtcccccaccttaaaacctctctctctaaaaccctatcaatcttccccccacttgctggccgttttgtga |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31438797 |
acatcgccatctctcccttctcaaacactcgtcccccaccttaaaacctctctctctaaaaccctatcaatcttccccccacttgctggccgttttgtga |
31438896 |
T |
 |
| Q |
111 |
ccgactctgccggtcacatctttatcacatgcaatgacgctggcgtagatttcatccatgccagcgccacggatctcactatcactcaccttttatcacc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31438897 |
ccgactctgccggtcacatctttatcacatgcaatgactctggcgtagatttcatccatgccagcgccacggatctcactatcactcaccttttatcacc |
31438996 |
T |
 |
| Q |
211 |
ccctgatgtccatc |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31438997 |
acctgatgtccatc |
31439010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University