View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12660_low_14 (Length: 388)
Name: NF12660_low_14
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12660_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 3e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 179 - 348
Target Start/End: Complemental strand, 31513664 - 31513494
Alignment:
| Q |
179 |
tgtttgtttgattcaaattaaaaggattaacctcgatccattcatgcctttaatgtccttaacattacatgtttagacgcataggtatttcagattttta |
278 |
Q |
| |
|
|||| |||||||||||| ||||||||||||| ||||| | ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31513664 |
tgttcgtttgattcaaactaaaaggattaacttcgattccttcatgcctttaatgtcgttaacattacatatttagacgcataggtatttcagattttta |
31513565 |
T |
|
| Q |
279 |
aaatttt-atatttatatacattttaccactttataccgttaacttgactactattagtttatttgcaagc |
348 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31513564 |
aaattttcatatttatatacattttactactttataccgttaacttgacatgaattagtttatttgcaagc |
31513494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 31513826 - 31513766
Alignment:
| Q |
15 |
tatatcatattaggtgaggtgaataatacatcctcttgtctaaattagtgatttccgtgga |
75 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31513826 |
tatatcatattaggtgagatgaataatacatcctcttgtctaaattagtgatttccgtgga |
31513766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University