View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12660_low_24 (Length: 322)
Name: NF12660_low_24
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12660_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 92 - 305
Target Start/End: Original strand, 35288770 - 35288983
Alignment:
| Q |
92 |
catgaacatcaacaaatgtgttaatttcatttgaagattttgattatgtgaagaattgttttacaagtaatggactaattggtgcatgcatgtgtgaggt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35288770 |
catgaacatcaacaaatgtgttaatttcatttgaagattttgattatgtgaagaattgttttacaagtaatggactaattggtgcatgcatgtgtgaggt |
35288869 |
T |
 |
| Q |
192 |
tttcaagcatcttttgcatttgtttagagatacagtagaatgatatttgtttttccttttaggctatgggaagaattcatgctattctatcagacggaac |
291 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35288870 |
tttcaagcatcttttgcatttgtttaaagatacagtagaatgatatttgtttttccttttaggctatgggaagaattcatgctattctatcagatggaac |
35288969 |
T |
 |
| Q |
292 |
tgtcgtcactgatg |
305 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
35288970 |
tgtcgtcaccgatg |
35288983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University