View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12660_low_29 (Length: 300)
Name: NF12660_low_29
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12660_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 30 - 289
Target Start/End: Original strand, 12921074 - 12921333
Alignment:
| Q |
30 |
caggcaactcaaaaggtaatacaaatcaactcaaaggggtaaagaaaccacaactagacaacccagaggatgggcaaatccaaatttgaagcaaatatct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12921074 |
caggcaactcaaaaggtaatacaaatcaactcaaaggggtaaagaaaccacaactagacaacccagaggacgggcaaatccaaatttgaagcaaatatct |
12921173 |
T |
 |
| Q |
130 |
acgcaccatgtgcacaatcaagcaaaaatgtgtacatgtacgaaaccaaattgcnnnnnnnttgtgtgtgaacgttcacgaccaccgaactcatatcttg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12921174 |
acgcaccatgtgcacaatcaagcaaaaatgtgtacatgtacgaaaccaaattgcaaaaaaattgtgtgtgaacgttcacgaccaccgaactcatatcttg |
12921273 |
T |
 |
| Q |
230 |
ataacgtcaaatgagctcggccgccaacatgaaagcagatccacacacctacaactctct |
289 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12921274 |
ataacgtcaaatgaactcggccgccaacatgaaagcagatccacacacctacaactctct |
12921333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University