View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12660_low_36 (Length: 277)

Name: NF12660_low_36
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12660_low_36
NF12660_low_36
[»] chr4 (1 HSPs)
chr4 (78-246)||(44594719-44594887)


Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 78 - 246
Target Start/End: Original strand, 44594719 - 44594887
Alignment:
78 ctagtggctatgtttctttctctcttagannnnnnnctatgagaaaaatggactatgttgggtttatattggaagattgtttacttgctttgatgccttt 177  Q
    ||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
44594719 ctagtggctatgtttctttctctcttgattttttttctatgagaaaaatggactatgttgggtttatattagaagattgtttacttgctttgatgccttt 44594818  T
178 ttgttaattattactatgttatgtaattttgatgctttgcttggtttcctcaccaaccttagtttctga 246  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
44594819 ttgttaattattactatgttatgtaattttgatggtttgcttggtttcctcaccaaccttagtttctga 44594887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University