View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12660_low_36 (Length: 277)
Name: NF12660_low_36
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12660_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 78 - 246
Target Start/End: Original strand, 44594719 - 44594887
Alignment:
| Q |
78 |
ctagtggctatgtttctttctctcttagannnnnnnctatgagaaaaatggactatgttgggtttatattggaagattgtttacttgctttgatgccttt |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44594719 |
ctagtggctatgtttctttctctcttgattttttttctatgagaaaaatggactatgttgggtttatattagaagattgtttacttgctttgatgccttt |
44594818 |
T |
 |
| Q |
178 |
ttgttaattattactatgttatgtaattttgatgctttgcttggtttcctcaccaaccttagtttctga |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44594819 |
ttgttaattattactatgttatgtaattttgatggtttgcttggtttcctcaccaaccttagtttctga |
44594887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University