View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12660_low_45 (Length: 249)
Name: NF12660_low_45
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12660_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 100 - 229
Target Start/End: Original strand, 36501085 - 36501214
Alignment:
| Q |
100 |
tattctagttgatttcaaagcagaaactaagaatggtataggtagatagggttaatgaaatgcaacctgcactagcccaccaagattatctctaagatcc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36501085 |
tattctagttgatttcaaagcagaaactaagaatggtataggtagatagggttaatgaaatgcaacctgcactagcccaccaagattatctctaagatcc |
36501184 |
T |
 |
| Q |
200 |
aatacaaaatatgaggcacccatgtcttga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36501185 |
aatacaaaatatgaggcacccatgtcttga |
36501214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 36500957 - 36501044
Alignment:
| Q |
1 |
atgggacaacaaaaacaatcttggcatttcctctcagccataatctgcactaacacacatgacacatctcatagaagccttatgcgtt |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36500957 |
atgggacaacaaaaacaatcttggcatttcctctcagccataatctgcactaacacacatgacacatctcatagaagccttatgcgtt |
36501044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University