View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12660_low_56 (Length: 236)
Name: NF12660_low_56
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12660_low_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 44594617 - 44594394
Alignment:
| Q |
1 |
ttgatcggagtaatgggcataccctgccgttgttcccacacctcccaatcccacatcactgaaatcatcatcaccagtttcttccgccataagtcttaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44594617 |
ttgatcggagtaatgggcataccctgccgttgttcccacacctcccaatcccacatcactgaaatcatcatcaccagtttcttccgccataagtcttaga |
44594518 |
T |
|
| Q |
101 |
tctttaatcattcattcctagctagcttgtagctatatacctattatggcacgttaagatataagaaag-nnnnnnnngtttaactttggttgaatttag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
44594517 |
tctttaatcattcattcctagctagcttgtagctatatacctattatggcacgttaagatataagaaagaaaaaagaagtttaactttagttgaatttag |
44594418 |
T |
|
| Q |
200 |
ctttgtgatcataaatatatatat |
223 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
44594417 |
ctttgtgatcataaatttatatat |
44594394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University