View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12660_low_69 (Length: 215)
Name: NF12660_low_69
Description: NF12660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12660_low_69 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 56 - 199
Target Start/End: Complemental strand, 22492583 - 22492440
Alignment:
| Q |
56 |
aatatgcacggtctttgcaaggtatatgaatggattaaaaaacttcaaatttcttccctctctaacaaaaaagcacttggaaacagtactaagtaactca |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22492583 |
aatatgcacggtgtttgcaaggtatatgaatggattaaaaaacttcaaatttcttccctctttaacaaaaaagcacttggaaacagtactaagtaactca |
22492484 |
T |
|
| Q |
156 |
tcattttttcactcatcaattctgtgtccttcaaaagtacctaa |
199 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
22492483 |
tcattttttcacacatcaattatgtgtccttcaaaagtacctaa |
22492440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 24 - 140
Target Start/End: Complemental strand, 22500182 - 22500067
Alignment:
| Q |
24 |
atacaaaacgaaaaaataagtactatctacacaatatgcacggtctttgcaaggtatatgaatggattaaaaaacttcaaatttcttccctctctaacaa |
123 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
22500182 |
atacaaaacgaaaaaataagcactatctacacaggatgcacggtctttgcaaggtatacgaatggattagaaaacttcaaatatcttccctctc-aacaa |
22500084 |
T |
|
| Q |
124 |
aaaagcacttggaaaca |
140 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
22500083 |
gaaagcacttggaaaca |
22500067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University