View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12661_high_11 (Length: 428)
Name: NF12661_high_11
Description: NF12661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12661_high_11 |
 | |
|
| [»] scaffold0018 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0018 (Bit Score: 166; Significance: 1e-88; HSPs: 3)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 8 - 232
Target Start/End: Complemental strand, 170894 - 170653
Alignment:
| Q |
8 |
cgagtgagatgaacctttctgcagcttgttggatttggaattcctttagatattgaagcttcttcttctcttgtaaccttcacatgagactttggttttt |
107 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
170894 |
cgagagagataaacctttctgcagcttgttggatttggaattcctttagatattgaagcttcttcttctcttgtaaccttcacatgagactttggttttt |
170795 |
T |
|
| Q |
108 |
ctcttcaggcttaataacaagtcccacatcgagtatatgttaaaacatagaagaaggtttac-----------------gtatcacttataaacccatag |
190 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
170794 |
ctcttcgggcataataacaagtcccacatcgagtatatgttaaaacatagaagaaggtttacctataaaataagagtgtgtatcacttattaacccatag |
170695 |
T |
|
| Q |
191 |
ttggggacccaatctcatacggttgttattcccatgatttga |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
170694 |
ttggggacccaatctcatacggttgttattcccatgatttga |
170653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 234 - 308
Target Start/End: Complemental strand, 170553 - 170479
Alignment:
| Q |
234 |
taatgactgtatataattaaaccaatttaatatttcaaaccttcattgttgagaagaaattactctaggggttct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
170553 |
taatgactgtatataattaaaccaatttaaaatttcaaaccttcattgttgagaagaaattactctaggggttct |
170479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 390 - 418
Target Start/End: Complemental strand, 170398 - 170370
Alignment:
| Q |
390 |
gttttggtctcttatatatgttttcaata |
418 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
170398 |
gttttggtctcttatatatgttttcaata |
170370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 48 - 154
Target Start/End: Original strand, 31045885 - 31045982
Alignment:
| Q |
48 |
ttcctttagatattgaagcttcttcttctcttgtaaccttcacatgagactttggtttttctcttcaggcttaataacaagtcccacatcgagtatatgt |
147 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
31045885 |
ttcctttatatattgaagctt----ttctcttgtaaccttcacatgaaactttcgtttttctcttca-----tataacaagtcccacatcgagtatgtgt |
31045975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University