View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12661_low_24 (Length: 359)
Name: NF12661_low_24
Description: NF12661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12661_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 213 - 343
Target Start/End: Original strand, 39033610 - 39033740
Alignment:
| Q |
213 |
tacttttgcatttttgaagtccctttatctttcccattttgttacgctcactcatgcaccttataaaacctattttatactttataaatgtcattttttc |
312 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
39033610 |
tacttttgcatttttgaagtccctgtatctttcccattttgttacgctcactcatgcaccttataaaacctattttatactttgtaaatgtccttttttc |
39033709 |
T |
 |
| Q |
313 |
ctttcgcaattagctgattttaacttttaac |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
39033710 |
ctttagcaattagctgattttaacttttaac |
39033740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University