View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12661_low_49 (Length: 213)
Name: NF12661_low_49
Description: NF12661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12661_low_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 3639669 - 3639491
Alignment:
| Q |
19 |
aataatactcaatttgacaacaaatatacttctcaaaattcacatgacacggccccgtccaagtaattttttatgataagtcgttaataattcaagtaag |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3639669 |
aataatactcaatttggcaacaaatatacttctcaaaattcacatgacacggccccgtccaagtaattttttatgataagtcgttaataattcaagtaag |
3639570 |
T |
|
| Q |
119 |
gaattactagcttatacacacacattaaaggtgttactactttaaagttgggacatatacatattaattttcacgtctg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3639569 |
gaattactagcttatacacacacattaaaggtgttactactttaaagttgggacatatacatattaattttcacgtctg |
3639491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University