View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12662_low_3 (Length: 261)
Name: NF12662_low_3
Description: NF12662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12662_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 20 - 142
Target Start/End: Complemental strand, 11199143 - 11199018
Alignment:
| Q |
20 |
ttagtaggcatagaatcaagatggtcacgtgcaaattggaaagcatgtttctgcaaaggaagagacatgtcacaagctttgacatgaatgctgtt---gt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11199143 |
ttagtaggcatagaatcaagatggtcacgtgcaaattggaaagcatgtttctgcaaaggaagagacatgtcacaagctttgacatgaatgctgttgttgt |
11199044 |
T |
 |
| Q |
117 |
tgagtttaatattatttttataatca |
142 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
11199043 |
tgagtttaatattatttttataatca |
11199018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 206 - 256
Target Start/End: Complemental strand, 11198954 - 11198904
Alignment:
| Q |
206 |
atcaaactgtttagaaacttgctccttctctctaactccttctctgcttct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11198954 |
atcaaactgtttagaaacttgctccttctctctaactccttctctgcttct |
11198904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University