View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12662_low_4 (Length: 250)
Name: NF12662_low_4
Description: NF12662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12662_low_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 56161575 - 56161819
Alignment:
| Q |
12 |
aaagggacaggaaggcaaaattccattgcggacatggtgttaaaaacggtacaagaaagttgtgatgtcaaaatcatatgtgaaggaaaagaagtgatcg |
111 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
56161575 |
aaagggccaggaaagcaaaattccattgcggacatggtgttaaaaaccgtacaagaaagttgtgatgtcaaaatcatatgtgaaggaaaagaagtaatcg |
56161674 |
T |
 |
| Q |
112 |
accagatgattaatgggttcagtacttcaaaacac------atcagaaacagtagcagttccagaatttctcatcatgtagaggaatcccatggttttgt |
205 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||| || ||||||||||||||||||| |
|
|
| T |
56161675 |
atcagatgattaatgggttcagtacttcaaaacacaccagaaacagaaacagtagcagttccacaatttctcatcaagttaaggaatcccatggttttgt |
56161774 |
T |
 |
| Q |
206 |
cccactcaagcttttgatgcccaatctatcttggttatttcggtc |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
56161775 |
cccactcaagcttttcatgcccaatctatcttggttatttaggtc |
56161819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University