View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12664_high_6 (Length: 230)
Name: NF12664_high_6
Description: NF12664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12664_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 52491113 - 52491314
Alignment:
| Q |
14 |
cagagagaggtgcgctaatcaacacacggcggacgtttgatggggctgtgaaatgaaccttgcggctcttgcgacagctgcttgaaagaagaagaaacat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
52491113 |
cagagagaggtgcgctaatcaacacacgacggacgtttgatggggcggtgaaatgaaccttgcggctcttgtgacagctgcttgaaagaagaagaaacgt |
52491212 |
T |
|
| Q |
114 |
ggatgaatcaattgcagatctgaannnnnnncgtattactcttctatgaaatcgtgaggaagaataatggaagcaaagaagaaggaaaacagggtgttgt |
213 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52491213 |
ggatgaatgaattgcagatctgaatttttttcgtattactcttctatgaaatcgtgaggaagaataatggaagcaaagaagaaggaaaacagggtgttgt |
52491312 |
T |
|
| Q |
214 |
tg |
215 |
Q |
| |
|
|| |
|
|
| T |
52491313 |
tg |
52491314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 31 - 215
Target Start/End: Complemental strand, 21946304 - 21946119
Alignment:
| Q |
31 |
atcaacacacggcggacgtttgatggggctgtgaaatgaaccttgcggctcttgcgacagctgcttgaaagaagaagaaacatggatgaatcaattgcag |
130 |
Q |
| |
|
||||||||||| |||||||||| || ||| || ||||||||||||||||||||||||| | |||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
21946304 |
atcaacacacgacggacgtttggtgtggcggtaaaatgaaccttgcggctcttgcgacggatgcttgaaagaagaagaaacatggctgaatgaattgcat |
21946205 |
T |
|
| Q |
131 |
atctgaa--nnnnnnncgtattactcttctatgaaatcgtgaggaagaataatggaagcaaagaagaaggaaaacagggtgttgttg |
215 |
Q |
| |
|
||||||| | |||| |||||||||| | | ||||| |||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
21946204 |
atctgaatttttttttcttatttctcttctatggagttgtgagaaagaataatggaagcaaagaagaa-gaaaacaaggtgttgttg |
21946119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 5404286 - 5404205
Alignment:
| Q |
19 |
agaggtgcgctaatcaacacacggcggacgtttgatggggctgtgaaatgaaccttgcggctcttgcgacagctgcttgaaa |
100 |
Q |
| |
|
||||||||||| ||||||||||| |||||| |||||||||| ||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
5404286 |
agaggtgcgctcatcaacacacgacggacgcttgatggggcggtgaaatgagccttgcggctcttgcgacggctgcttgaaa |
5404205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 70 - 137
Target Start/End: Original strand, 30927165 - 30927232
Alignment:
| Q |
70 |
accttgcggctcttgcgacagctgcttgaaagaagaagaaacatggatgaatcaattgcagatctgaa |
137 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
30927165 |
accttgcggctcttccgacggttgcttgaaagaagaagaaacatggatgaatgaattgcatatctgaa |
30927232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 3085563 - 3085630
Alignment:
| Q |
16 |
gagagaggtgcgctaatcaacacacggcggacgtttgatggggctgtgaaatgaaccttgcggctctt |
83 |
Q |
| |
|
||||| |||||||| || || |||||||||||| ||||||| || ||||||||| |||| |||||||| |
|
|
| T |
3085563 |
gagagtggtgcgctcattaagacacggcggacgcttgatggcgccgtgaaatgagccttacggctctt |
3085630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University