View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12664_low_6 (Length: 277)
Name: NF12664_low_6
Description: NF12664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12664_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 20 - 269
Target Start/End: Original strand, 55076616 - 55076865
Alignment:
| Q |
20 |
tcaaggaccatgtcgtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtggga |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076616 |
tcaaggaccctgtcgtgccttccttggtgaccttgctgccggtgatcaccgtagaatgagaatgggcaatgccatgttctctttcttcatggccgtggga |
55076715 |
T |
 |
| Q |
120 |
aatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076716 |
aatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaa |
55076815 |
T |
 |
| Q |
220 |
catgtttcttcttatcaatattccttctcgctctcgtttcttcctttgct |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076816 |
catgtttcttcttatcaatattccttctcgctctcgtttcttcctttgct |
55076865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 20 - 145
Target Start/End: Complemental strand, 15125437 - 15125312
Alignment:
| Q |
20 |
tcaaggaccatgtcgtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtggga |
119 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| |||| ||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||| || |
|
|
| T |
15125437 |
tcaaggaccttgtcgtgccttcattggtgacctcgctggtggtgatcaccgtcgaatgagaattggcaatgggatgttctcttttttcatggccgtcggt |
15125338 |
T |
 |
| Q |
120 |
aatatccttggttatgccgccggctc |
145 |
Q |
| |
|
||| ||||||||||||| || ||||| |
|
|
| T |
15125337 |
aatgtccttggttatgctgctggctc |
15125312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 190
Target Start/End: Complemental strand, 43665688 - 43665606
Alignment:
| Q |
108 |
atggccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagc |
190 |
Q |
| |
|
|||||||| || || ||||| ||||| |||||||| ||| ||||||||||| |||| ||||||| |||||| |||| ||||| |
|
|
| T |
43665688 |
atggccgtcggtaacatcctcggttacgccgccggtgcttacagcaaactctttcacgtgtttccgttcaccaaaacaaaagc |
43665606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University