View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12666_high_2 (Length: 227)
Name: NF12666_high_2
Description: NF12666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12666_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 41706077 - 41705882
Alignment:
| Q |
14 |
cagagatatagtagtaatagtgatggataaggaaattatcttaacatgtgttttaaacattctctgtgtagtcggccccacttaatgctactgcgataag |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||| |
|
|
| T |
41706077 |
cagacatatagtagtaatagtgatggataaggaaattatcttaacatgtgttttaaacattctctgtgtagtaggccccacttagtactactgcgataag |
41705978 |
T |
 |
| Q |
114 |
acttggttgttgttgttctaattgatgatgcgttttaaatattatatcaattgtttgaaccctgaattcactaacagatattaacaatgtaactct |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| ||| ||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41705977 |
acttggttgttgttgttctagttgatgatgcattttaaacattctatcagttgtttgaaccctgaattcactaacagatattaacagtgtaactct |
41705882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University