View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12669_high_12 (Length: 219)

Name: NF12669_high_12
Description: NF12669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12669_high_12
NF12669_high_12
[»] chr1 (2 HSPs)
chr1 (1-86)||(50567657-50567742)
chr1 (155-219)||(50567813-50567877)


Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 50567657 - 50567742
Alignment:
1 gtgataacgagaggaagaaaggaactccatggactgaagaagaacacaggtatctcaagattctcaaagattttacttcaattcaa 86  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50567657 gtgataacgagaggaagaaaggaactccatggactgaagaagaacacaggtatctcaagattctcaaagattttacttcaattcaa 50567742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 155 - 219
Target Start/End: Original strand, 50567813 - 50567877
Alignment:
155 acgtaactttttggaattggatgccataattttaaggaatgggaataaaaaattaatttttatct 219  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||    
50567813 acgtaactttttggaattggatgccataattttaaggaataggaataaaaaattaattttaatct 50567877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University