View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12669_high_8 (Length: 245)
Name: NF12669_high_8
Description: NF12669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12669_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 14 - 226
Target Start/End: Original strand, 44801453 - 44801662
Alignment:
| Q |
14 |
agatgaaagttagggtttctaagtgtttgagagagatggtttcttatgaaagggaccgtgtgaaagtggacnnnnnnnnaccatcacatatgtaagacat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44801453 |
agatgaaagttagggtttctaagtgtttgagagagatggtttcttatgaaagggaccgtgtgaaagtggacttttttttaccatcacatatgtaagacat |
44801552 |
T |
 |
| Q |
114 |
aaattttactacaatttaattnnnnnnnctatttgcatagtgctcgttgtattttacatattagattggtttagtttgtccggttcactagttcatattc |
213 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44801553 |
aaattttactacaatttaattaaaaaaactatttgcatagtgctcgttgtattttacatattagattggtttagtttgtccggttcactagttca---tc |
44801649 |
T |
 |
| Q |
214 |
taatcaacttata |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44801650 |
taatcaacttata |
44801662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University