View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12669_low_16 (Length: 219)
Name: NF12669_low_16
Description: NF12669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12669_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 50567657 - 50567742
Alignment:
| Q |
1 |
gtgataacgagaggaagaaaggaactccatggactgaagaagaacacaggtatctcaagattctcaaagattttacttcaattcaa |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50567657 |
gtgataacgagaggaagaaaggaactccatggactgaagaagaacacaggtatctcaagattctcaaagattttacttcaattcaa |
50567742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 155 - 219
Target Start/End: Original strand, 50567813 - 50567877
Alignment:
| Q |
155 |
acgtaactttttggaattggatgccataattttaaggaatgggaataaaaaattaatttttatct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
50567813 |
acgtaactttttggaattggatgccataattttaaggaataggaataaaaaattaattttaatct |
50567877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University