View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12669_low_18 (Length: 212)
Name: NF12669_low_18
Description: NF12669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12669_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 34 - 193
Target Start/End: Original strand, 23663951 - 23664110
Alignment:
| Q |
34 |
gatcatatggggtttcaaattggtattggtaatggtaactcaacttctgtttctgtttctgcttcttctgttgctggaggtgtcggagttgaaccatggc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23663951 |
gatcatatggggtttcaaattggtattggtaatggtaactcaacttctgtttctgtttctgcttcttctgttgctggaggtgtcggagttgaaccatggc |
23664050 |
T |
 |
| Q |
134 |
gtaatttgcagcaatttcctttcttgaatactttcgaatcaaactcttctggaaataatc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23664051 |
gtaatttgcagcaatttcctttcttgaatactttcgaatcaaactcttctggaaataatc |
23664110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University