View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1266_high_27 (Length: 252)

Name: NF1266_high_27
Description: NF1266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1266_high_27
NF1266_high_27
[»] chr6 (2 HSPs)
chr6 (184-242)||(34100148-34100206)
chr6 (1-50)||(34100338-34100387)


Alignment Details
Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 242
Target Start/End: Complemental strand, 34100206 - 34100148
Alignment:
184 gggaagccctagaaagacaagtaagtatatatagttagtaataataactgagagtataa 242  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
34100206 gggaagccctagagagacaagtaagtatatatagttagtaataataactgagagtataa 34100148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 34100387 - 34100338
Alignment:
1 caacaagagatattcattaacagctagaattgaaaagttaaaaagaagaa 50  Q
    |||||||||||||||||||||||||||||||||||||  |||||||||||    
34100387 caacaagagatattcattaacagctagaattgaaaaggaaaaaagaagaa 34100338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University