View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1266_high_28 (Length: 251)
Name: NF1266_high_28
Description: NF1266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1266_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 28 - 244
Target Start/End: Original strand, 36958466 - 36958679
Alignment:
| Q |
28 |
agctttagctgattagcatagtcttcaactcgtcatcattaattcaacatcttaattgcagatatatttcccaacttttggggtaatacaatataaaatt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36958466 |
agctttagctgattagcatagtcttcaactcgtcatcatcaattcaacatcttaatttcagatatatttcccaactttgggggtaatacaatataaaatt |
36958565 |
T |
 |
| Q |
128 |
ttagagaataaaaatagaaaaagggagtgcataaattgcctgtttgttcccatcattgcacatttccactgtgcttaaattttagaggatgaaatgttgt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||| ||| |
|
|
| T |
36958566 |
ttagagaataaaaatagaaaaagggagtgcataaattgcctgtttgttcccatcattgcatatttccactgggctcaaattttagaggatgaaa---tgt |
36958662 |
T |
 |
| Q |
228 |
tattcatcttcatctca |
244 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36958663 |
tattcatcttcatctca |
36958679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University