View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1266_high_36 (Length: 202)
Name: NF1266_high_36
Description: NF1266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1266_high_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 5645615 - 5645539
Alignment:
| Q |
1 |
ataggctagaggaatggctgcccaactcttggcaatccttatcttagtcggataggaaggaacaggagtcatgatgt |
77 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
5645615 |
atagactagaggaatggctgcccaactcttggcaatccttatcttagtcggataggaagaaacaagagtcatgatgt |
5645539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University