View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1266_low_35 (Length: 320)
Name: NF1266_low_35
Description: NF1266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1266_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 43062306 - 43062549
Alignment:
| Q |
1 |
tctcaattgaaaaacctgcaattcgagaaaaatgaagcatgcatagttaattaattaatgtagcaatttggttagag------------agaaaggaacc |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43062306 |
tctcaattgaaaaacctgcaattcgagaaaa-tgaagcatgcatagttaattaattaatgtagcaatttggttagagagagagagagagagaaaggaacc |
43062404 |
T |
|
| Q |
89 |
ttgtatccggtgtaaatatcaacggctcgaacccaaaactgaaaggaacgttgaataggacgaaactgaagggagagtttttgtttaatgtcgttgagat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062405 |
ttgtatccggtgtaaatatcaacggctcgaacccaaaactgaaaggaacgttgaataggacgaaactgaagggagagtttttgtttaatgtcgttgagat |
43062504 |
T |
|
| Q |
189 |
caacgacgatagggggcaacataactcaattaactacactacact |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062505 |
caacgacgatagggggcaacataactcaattaactacactacact |
43062549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University