View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1266_low_43 (Length: 299)
Name: NF1266_low_43
Description: NF1266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1266_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 64 - 223
Target Start/End: Original strand, 27303546 - 27303700
Alignment:
| Q |
64 |
atcaacaattgtaaggataaaatatgtaaaactagctaacacaatattttgagaaatttattactaaaattagttttttaattaatgtgatttttcattt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27303546 |
atcaacaattgtaaggataaaatatgtaaaactagctaacacaatattttgagaattttattactaaaattagttttttaataaatgtgatttttcattt |
27303645 |
T |
 |
| Q |
164 |
gtaagttgatatttcatttcttacaaaatttcattatgtgtttatttcaagttatcattg |
223 |
Q |
| |
|
| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27303646 |
g-----tgatatttcattgcttacaaaatttcattatgtgtttatttcaagttatcattg |
27303700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University