View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1266_low_47 (Length: 291)
Name: NF1266_low_47
Description: NF1266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1266_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 60 - 278
Target Start/End: Original strand, 40241025 - 40241237
Alignment:
| Q |
60 |
gcacgttatagaacactggtggaacgaatgataattgaacacgtaagtgtgttgtgttttgaaacaaaacatcaaaacgacatcgtacaacatgtgtgtt |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
40241025 |
gcacgttatagaacactggtggaacgaatgataattgaacacgtaagagtgttgtgttttgaaacaaaacatcaaaacgacatcgtagaacttgtgtgtt |
40241124 |
T |
 |
| Q |
160 |
aaagaaacataaacataataacatcgtcatcgtagatataaatatttattattagttgctgttcaacttcagttttcattttatcttcttcttcttcttt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40241125 |
aaagaaacataaacataataacatcgtcatcgtagatataaatatttattattagttgctgttcaacttcagttttcatttta------tcttcttcttt |
40241218 |
T |
 |
| Q |
260 |
cctccctctctcgccccct |
278 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40241219 |
cctccctctctcgccccct |
40241237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University