View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1266_low_61 (Length: 262)

Name: NF1266_low_61
Description: NF1266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1266_low_61
NF1266_low_61
[»] chr2 (1 HSPs)
chr2 (32-104)||(41177474-41177546)


Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 32 - 104
Target Start/End: Complemental strand, 41177546 - 41177474
Alignment:
32 cttgtttaaacgatgtgattatgacctgtaccactttgtaacaaacaattacccaattacatacattacatcg 104  Q
    ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
41177546 cttgtttaaccgatgtgattatgacctgtaccactttgtaacaaaaaattacccaattacatacattacatcg 41177474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University