View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1266_low_62 (Length: 260)
Name: NF1266_low_62
Description: NF1266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1266_low_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 32062688 - 32062918
Alignment:
| Q |
1 |
cttacactatacttaattggtagtatcagtactactattacgaaccgacctctaccgaaactacatacctctgcatgtatcgaattcttcccatgttgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32062688 |
cttacactatacttaattggtagtaccagtactactattacgaaccgacctctaccgaaactacatacctctgcatgtatcgaattcttctcatgttgtg |
32062787 |
T |
|
| Q |
101 |
tactgcaaactcgtaccacataccaatacgaattacaaattatgttgattatggtttgattcggtagttgttgtgttgtccggttaccagtccgactggg |
200 |
Q |
| |
|
|| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32062788 |
taatgcgaactcgtaccacataccaatacgaattacaaattatgttgattatggtttgattcggtagttgttgtgttgtccggttaccagtccgactggg |
32062887 |
T |
|
| Q |
201 |
aaatgattctattgcagcagctgttttctgt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32062888 |
aaatgattctattgcagcagctgttttctgt |
32062918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 157
Target Start/End: Complemental strand, 38695321 - 38695267
Alignment:
| Q |
101 |
tactgcaaactcgtaccacataccaatacgaattacaaattatgttgattatggttt |
157 |
Q |
| |
|
||||||||||||||||||| |||||| || |||| ||||||||| |||||||||||| |
|
|
| T |
38695321 |
tactgcaaactcgtaccac-taccaacacaaattgcaaattatg-tgattatggttt |
38695267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University