View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1266_low_67 (Length: 254)
Name: NF1266_low_67
Description: NF1266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1266_low_67 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 138 - 254
Target Start/End: Complemental strand, 34100653 - 34100537
Alignment:
| Q |
138 |
gtgtaatcatgtgtatacataagtcacggatggtgctctaaaccctcaacacacaaacaccggattacatccatccagcgacaaaaatcaaaacaaaaga |
237 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34100653 |
gtgtaatcatgtgtatacattagtcacggatggggctctaaaccctcaacacacaaacaccggattacatccatccagcgacgaaaatcaaaacaaaaga |
34100554 |
T |
 |
| Q |
238 |
ggcactgaatcaatgtc |
254 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34100553 |
ggcactgaatcaatgtc |
34100537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University