View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1266_low_77 (Length: 250)
Name: NF1266_low_77
Description: NF1266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1266_low_77 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 2521500 - 2521744
Alignment:
| Q |
1 |
atataatatgtctcctatgattccattattttggaaactactcacattttactttcgcttaacttatttcatgcagcttggtgggatgaattcctttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2521500 |
atataatatgtctcctatgattccattattctggaaactactcacattttactttcgcttaacttatttcatgcagcttggtgggatgaattcctttttg |
2521599 |
T |
 |
| Q |
101 |
ttaactgaatttgagcattcgataccactgttttcaaaaatacctacattggttattggaatggatgtttcacatggatctcaaggtcaatcagaagcac |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2521600 |
ttaactgaatttaagcattcgataccactgttttcaaaaatacctacattggttattggaatggatgtttcacatggatctcaaggtcaatcagaagcac |
2521699 |
T |
 |
| Q |
201 |
tatccattgctgcgatatggtataactttaggttttcatctcact |
245 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
2521700 |
tatccattgctgcggtatggtataactttaggttttcatgtcact |
2521744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University