View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1266_low_81 (Length: 228)
Name: NF1266_low_81
Description: NF1266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1266_low_81 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 158 - 228
Target Start/End: Original strand, 12049626 - 12049696
Alignment:
| Q |
158 |
cctcgatggtgttggggaaggtgagagcgacgacatcgttgggtttgattccagcggagatgaaatgatta |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12049626 |
cctcgatggtgttggggaaggtgagagcgacgacatcgttgggtttgattccagcggagatgagatgatta |
12049696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 17 - 76
Target Start/End: Original strand, 12049485 - 12049544
Alignment:
| Q |
17 |
attatttttacaattgatttatgctgtatctttgtgggtaatgtattttaaatgttgact |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12049485 |
attatttttacaattgatttatgctgtatctttgtgggtaatgtattttaaatgttgact |
12049544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University