View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12670_high_14 (Length: 260)
Name: NF12670_high_14
Description: NF12670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12670_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 113 - 255
Target Start/End: Original strand, 52988740 - 52988882
Alignment:
| Q |
113 |
gaggagccgtcgtttgtgtcgccacatccatttttgtggacatgatgttgatttgacgatttacaactttttcctccatgcttgtgccctcttggcagaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52988740 |
gaggagccgtcgtttgtgtcgccacatccatttttgtggacatgatgttgatttgacgatttacaactttttcctccatgcttgtgccctcttggcagaa |
52988839 |
T |
|
| Q |
213 |
gtaacatgctgtttaaaatgaccaacagacatgttccaacgtc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52988840 |
gtaacatgctgtttaaaatgaccaacagacatgttccaacgtc |
52988882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 52988657 - 52988699
Alignment:
| Q |
18 |
acttctggggctgagctttttctgagcaacaatgcttatggct |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52988657 |
acttctggggctgagctttttctgagcaacaacgcttatggct |
52988699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University