View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12670_high_6 (Length: 380)
Name: NF12670_high_6
Description: NF12670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12670_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 15 - 371
Target Start/End: Original strand, 12017700 - 12018056
Alignment:
| Q |
15 |
gttggatggtacataaggtttgtagaagtcactagtatctgtagtctgccaccgatattaaagttgaattgcaactttttcattcagaagctgaattttt |
114 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12017700 |
gttggatggtacataaggttcgtagaagtcaatagtatctgtagtctgccaccgatattaaagttgaattgcaactttttcatttagaagctgaattttt |
12017799 |
T |
 |
| Q |
115 |
cttttgattaggaatgctcaaacaagccaactttcgcatcctctgcctgttctacgtgctagtgaaattgatgaatggtcaagaagttcagcttataaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12017800 |
cttttgattaggaatgctcaaacaagccaactttcgcatcctctgcctgttctacgtgctagtgaaattgatgaatggtcaagaagttcagcttataaat |
12017899 |
T |
 |
| Q |
215 |
ctcttttgaaacgtggaacacttattcgatcacaccaacagcaaaaattctaggagtgcccacattgttctaaatgcacaacagttcaatgttcttcatg |
314 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12017900 |
ctcttttgaaacgtggaacacctattcgatcacaccaacagaaaaaattctaggagtgcccacattgttctaaatgcacaacagttcaatgttcttcatg |
12017999 |
T |
 |
| Q |
315 |
gttagtttcttaaaactctgcaatttctgttttattccgtgtttctatgcttcatct |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12018000 |
gttagtttcttaaaactctgcaatttctgttttattttgtgtttctatgcttcatct |
12018056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University